Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 400006
• Name: oriT_MiniICESt3
• Sequence Completeness: intact
• NCBI accession of oriT (coordinates [strand]): -
• oriT length: 213 nt
• IRs (inverted repeats): 1..8, 12..19 (GCCTGACC..GGTCAGGC) 61..67, 80..86 ( AACCCCC..GGGGGTT) 154..159, 163..168 ( AAAGTG..CACTTT) 177..181, 185..189 ( AAGTG..CACTT)
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: oriT_ICESt3

oriT sequence

• Length: 213 nt

>oriT_MiniICESt3
GCCTGACCACAGGTCAGGCGCAGACCGTAGCCCGAAGTTCCTAGGCCATGATGAGACTTCAACCCCCGATTTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGATTTCAAGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAGTCAAAAGGAGGTGTTCCCATGA

oriT secondary structure

Predicted by RNAfold.

Reference

[1] Carraro N et al. (2016) Plasmid-like replication of a minimal Streptococcal Integrative and Conjugative Element. Microbiology. . [PMID:26825653]

Host bacterium

• ID: 61
• Element name: MiniICESt3
• GenBank: _
• Element size: _
• Coordinate of oriT [Strand]: _

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -