Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 400005 |
| Name | oriT_Tn5062  |
| Organism | Synthetic construct for Streptomyces coelicolor |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | AJ566337 (2756..2856 [-], 101 nt) |
| oriT length | 101 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RK2 |
oriT sequence
Download Length: 101 nt
>oriT_Tn5062
AGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGG
AGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGG
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Bishop A et al. (2004) Systematic insertional mutagenesis of a streptomycete genome: a link between osmoadaptation and antibiotic production. Genome Res. 14(5):893-900. [PMID:15078860]
Host bacterium
| ID | 5 | Element type | |
| Element name | Synthetic construct for Streptomyces coelicolor transposon Tn5062 | GenBank | AJ566337 |
| Element size | 3442 bp | Coordinate of oriT [Strand] | 2756..2856 [-] |
| Host bacterium | Synthetic construct for Streptomyces coelicolor |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |