Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 400001 |
| Name | oriT_TnLoxp53  |
| Organism | Synthetic construct Streptomyces coelicolor |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | HQ259114 (2940..3044 [-], 105 nt) |
| oriT length | 105 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RK2 |
oriT sequence
Download Length: 105 nt
>oriT_TnLoxp53
AGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCG
AGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCG
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Fernández-Martínez LT et al. (2011) A transposon insertion single-gene knockout library and new ordered cosmid library for the model organism Streptomyces coelicolor A3(2). Antonie Van Leeuwenhoek. 99(3):515-22. [PMID:20945092]
Host bacterium
| ID | 1 | Element type | |
| Element name | Synthetic construct Streptomyces coelicolor transposon TnLoxp53 | GenBank | HQ259114 |
| Element size | 3634 bp | Coordinate of oriT [Strand] | 2940..3044 [-] |
| Host bacterium | Synthetic construct Streptomyces coelicolor |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |