Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300470
Name   oriT_pAM120 experimental
Organism   Cloning vector pAM120
Sequence Completeness      intact
NCBI accession of oriT (coordinates [strand])   U49939 (_)
oriT length   216 nt
IRs (inverted repeats)      61..76, 80..95  (ACTTAACCCCCCGTAT..ACAGGGGGGTACAAAT)
  123..134, 139..150  (GAAAATCCTTTG..CAAGGGATTTAC)
Location of nic site      135..136
Conserved sequence flanking the
  nic site  
 
 TGG|T
Note   oriT_Tn916

  oriT sequence  


Download         Length: 216 nt

>oriT_pAM120
AAGCGGAAGTCGCAGGTGTGGACTGATCTTGCTGGCTGGTGTGGCAATAGCCACGCCAGCACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCCTTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATACGGCCTTTTTGATTGGAGGGATTT

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Gawron-Burke C et al. (1984) Regeneration of insertionally inactivated streptococcal DNA fragments after excision of transposon Tn916 in Escherichia coli: strategy for targeting and cloning of genes from gram-positive bacteria. J Bacteriol. 159(1):214-21. [PMID:6330031]


Host bacterium


ID   1455 GenBank   U49939
Plasmid name   Cloning vector pAM120 Incompatibility group   -
Plasmid size   23363 bp Coordinate of oriT [Strand]   
Host baterium   Cloning vector pAM120

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -