Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300469 |
| Name | oriT_pBHA-1  |
| Organism | complete DEFINITION |
| Sequence Completeness | core |
| NCBI accession of oriT (coordinates [strand]) | A13198 (_) |
| oriT length | 38 nt |
| IRs (inverted repeats) | 7..bp: 2..8, 13..19 (ACTTTAT..ATAAAGT) 9..bp: 14..22, 29..37 (TAAAGTATA..TATACTTTA) |
| Location of nic site | 27..28 |
| Conserved sequence flanking the nic site |
|
| Note | oriT_pMV158 |
oriT sequence
Download Length: 38 nt
>oriT_pBHA-1
CACTTTATGAATATAAAGTATAGTGTGTTATACTTTAC
CACTTTATGAATATAAAGTATAGTGTGTTATACTTTAC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Grohmann E et al. (2003) Conjugative plasmid transfer in gram-positive bacteria. Microbiol Mol Biol Rev. 67(2):277-301. [PMID:12794193]
Host bacterium
| ID | 682 | GenBank | A13198 |
| Plasmid name | synthetic construct pBHA-1 | Incompatibility group | ColRNAI |
| Plasmid size | 7336 bp | Coordinate of oriT [Strand] | |
| Host baterium | complete DEFINITION |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |