Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300468 |
| Name | oriT_pFL129  |
| Organism | Escherichia coli |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | NC_005923 (_) |
| oriT length | 112 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RP4/RK2 |
oriT sequence
Download Length: 112 nt
>oriT_pFL129
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 681 | GenBank | NC_005923 |
| Plasmid name | pFL129 | Incompatibility group | IncX2 |
| Plasmid size | 6464 bp | Coordinate of oriT [Strand] | |
| Host baterium | Escherichia coli |
Cargo genes
| Drug resistance gene | catA1, tet(A) |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |