Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300468
Name   oriT_pFL129 in_silico
Organism   Escherichia coli
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   NC_005923 (_)
oriT length   112 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4/RK2

  oriT sequence  


Download         Length: 112 nt

>oriT_pFL129
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   681 GenBank   NC_005923
Plasmid name   pFL129 Incompatibility group   IncX2
Plasmid size   6464 bp Coordinate of oriT [Strand]   
Host baterium   Escherichia coli

Cargo genes


Drug resistance gene   catA1, tet(A)
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -