Detailed information of oriT

oriT

The information of the oriT region


oriTDB ID   300465
Name   oriT_pSB4 in_silico
Organism   Cloning vector pSB4 tetR tetA hygromycin resistance genes with Agrobacterium tumefaciens
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   AB027254 (29483..29849 [-], 367 nt)
oriT length   367 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site    		  
Note   oriT_RP4/RK2

  oriT sequence  


Download         Length: 367 nt

>oriT_pSB4
CCGCTTGCCCTCATCTGTTACGCCGGCGGTAGCCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCCGAAGCAGGGTTATGCAGCGGAAAAGCGCTGCTTCCCTGCTGTTTTGTGGAATATCTACCGACTGGAAACAGGCAAATGCAGGAAATTACTGAACTGAGGGGACAGGCGAGAGACG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Komari T et al. (1996) Vectors carrying two separate T-DNAs for co-transformation of higher plants mediated by Agrobacterium tumefaciens and segregation of transformants free from selection markers. Plant J. 10(1):165-74. [PMID:8758986]


Host bacterium

ID   678 GenBank   AB027254
Plasmid name   Cloning vector pSB4 tetR, tetA, hygromycin resistance genes with Agrobacterium tumefaciens DNA insert Incompatibility group   ColRNAI
Plasmid size   39902 bp Coordinate of oriT [Strand]   29483..29849 [-]
Host baterium   Cloning vector pSB4 tetR tetA hygromycin resistance genes with Agrobacterium tumefaciens

Cargo genes

Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -