Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300464 |
| Name | oriT_pSB1  |
| Organism | Cloning vector pSB1 tetR tetA genes with Agrobacterium tumefaciens |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | AB027255 (26522..26633 [-], 112 nt) |
| oriT length | 112 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RP4/RK2 |
oriT sequence
Download Length: 112 nt
>oriT_pSB1
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Komari T et al. (1996) Vectors carrying two separate T-DNAs for co-transformation of higher plants mediated by Agrobacterium tumefaciens and segregation of transformants free from selection markers. Plant J. 10(1):165-74. [PMID:8758986]
Host bacterium
| ID | 677 | GenBank | AB027255 |
| Plasmid name | Cloning vector pSB1 tetR, tetA genes with Agrobacterium tumefaciens DNA insert | Incompatibility group | ColRNAI |
| Plasmid size | 36909 bp | Coordinate of oriT [Strand] | 26522..26633 [-] |
| Host baterium | Cloning vector pSB1 tetR tetA genes with Agrobacterium tumefaciens |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |