Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300462
Name   oriT_pBT20-Dbla-T7pol experimental
Organism   Expression vector pBT20-Dbla-T7pol
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   EF153732 (_)
oriT length   242 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4 ?

  oriT sequence  


Download         Length: 242 nt

>oriT_pBT20-Dbla-T7pol
TTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCG

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   675 GenBank   EF153732
Plasmid name   Expression vector pBT20-Dbla-T7pol Incompatibility group   -
Plasmid size   9952 bp Coordinate of oriT [Strand]   
Host baterium   Expression vector pBT20-Dbla-T7pol

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -