Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300460
Name   oriT_pVMGCRT85 in_silico
Organism   Cloning vector pVMGCRT85
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   EU232662 (_)
oriT length   322 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4/RK2

  oriT sequence  


Download         Length: 322 nt

>oriT_pVMGCRT85
TGATAGGTGGGCTGCCCTTCCTGGTTGGCTTGGTTTCATCAGCCATCCGCTTGCCCTCATCTGTTACGCCGGCGGTAGCCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCCGAAGCAGGGTTATGCAGCGGAAAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Gao M et al. (2008) RIVET-a tool for in vivo analysis of symbiotically relevant gene expression in Sinorhizobium meliloti. Mol Plant Microbe Interact. 21(2):162-70. [PMID:18184060]


Host bacterium


ID   673 GenBank   EU232662
Plasmid name   Cloning vector pVMGCRT85 Incompatibility group   ColRNAI
Plasmid size   11368 bp Coordinate of oriT [Strand]   
Host baterium   Cloning vector pVMGCRT85

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -