Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300458
Name   oriT_pFlpAB-3 experimental
Organism   Cloning vector pFlpAB-3
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   EU329003 (_)
oriT length   261 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RK2

  oriT sequence  


Download         Length: 261 nt

>oriT_pFlpAB-3
CTTAAGGTATACTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGATAAGCT

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Barrett AR et al. (2008) Genetic tools for allelic replacement in Burkholderia species. Appl Environ Microbiol. 74(14):4498-508. [PMID:18502918]


Host bacterium


ID   671 GenBank   EU329003
Plasmid name   Cloning vector pFlpAB-3 Incompatibility group   ColRNAI
Plasmid size   10793 bp Coordinate of oriT [Strand]   
Host baterium   Cloning vector pFlpAB-3

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -