Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300456
Name   oriT_pTNS2-Easd in_silico
Organism   Vector pTNS2-Easd
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   EU626137 (_)
oriT length   260 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4/RK2

  oriT sequence  


Download         Length: 260 nt

>oriT_pTNS2-Easd
TTAAGGTATACTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGATAAGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   669 GenBank   EU626137
Plasmid name   Vector pTNS2-Easd Incompatibility group   -
Plasmid size   10110 bp Coordinate of oriT [Strand]   
Host baterium   Vector pTNS2-Easd

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -