Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300451
Name   oriT_pHERD26T experimental
Organism   Escherichia-Pseudomonas shuttle vector pHERD26T
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   EU603327 (_)
oriT length   268 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4

  oriT sequence  


Download         Length: 268 nt

>oriT_pHERD26T
GGGATTCCTTAAGGTATACTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGATAAGCT

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Qiu D et al. (2008) PBAD-based shuttle vectors for functional analysis of toxic and highly regulated genes in Pseudomonas and Burkholderia spp. and other bacteria. Appl Environ Microbiol. 74(23):7422-6. [PMID:18849445]


Host bacterium


ID   664 GenBank   EU603327
Plasmid name   Escherichia-Pseudomonas shuttle vector pHERD26T Incompatibility group   ColRNAI
Plasmid size   6166 bp Coordinate of oriT [Strand]   
Host baterium   Escherichia-Pseudomonas shuttle vector pHERD26T

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -