Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300449
Name   oriT_pHBurk3 experimental
Organism   Himar1-delivery and mutagenesis vector pHBurk3
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   EU919403 (_)
oriT length   260 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RK2

  oriT sequence  


Download         Length: 260 nt

>oriT_pHBurk3
TTAAGGTATACTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGATAAGCT

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Rholl DA et al. (2008) In vivo Himar1 transposon mutagenesis of Burkholderia pseudomallei. Appl Environ Microbiol. 74(24):7529-35. [PMID:18952878]


Host bacterium


ID   662 GenBank   EU919403
Plasmid name   Himar1-delivery and mutagenesis vector pHBurk3 Incompatibility group   ColRNAI
Plasmid size   7212 bp Coordinate of oriT [Strand]   
Host baterium   Himar1-delivery and mutagenesis vector pHBurk3

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -