Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300445
Name   oriT_pPSX experimental
Organism   Cloning vector pPSX
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   FJ422118 (12580..12981 [-], 402 nt)
oriT length   402 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oirT_pR388

  oriT sequence  


Download         Length: 402 nt

>oriT_pPSX
CTCATTTTCTGCATCATTGTAGCACCATCATAGCATTATAGTTGCATCATTGCTGCACGATAACCCAATGCGCATAGCGCATTGGGAGCAGTTTTGACCCTCTTTAGGGTCACGCTGGCGTTATCGCATGGTTTCCGTCCTTAAAAGCCGGGTTGGTATCCTTAAATCTGGGCTATAGACAATACGCACCTTTCGGTGCGCGTAAGTCATTGATTTACAATGACTTCCACGCCAAGGACGAAAACCTGTGTAGTGTTATGCCACTACAATATTGCCGCAACCCCTTGTAAATGCTAGGATTGAACCACTACAGTAACACTACGGGAGAGGACATGGCACTAGGCGACCCCATCCAAGTACGGCTAAGCCCGGAAAAGCAGGCACTTTTGGAGGACGAGGCGG

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Sarovich DS et al. (2007) pPSX: a novel vector for the cloning and heterologous expression of antitumor antibiotic gene clusters. Plasmid. 57(3):306-13. [PMID:17218012]


Host bacterium


ID   658 GenBank   FJ422118
Plasmid name   Cloning vector pPSX Incompatibility group   IncW
Plasmid size   14757 bp Coordinate of oriT [Strand]   12580..12981 [-]
Host baterium   Cloning vector pPSX

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -