Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300443 |
| Name | oriT_pIND4  |
| Organism | Expression |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | FM164773 (_) |
| oriT length | 38 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_pIP501 |
oriT sequence
Download Length: 38 nt
>oriT_pIND4
TGAATGGCGCACACTATGCAAACTCTGCGAGTTTGCGT
TGAATGGCGCACACTATGCAAACTCTGCGAGTTTGCGT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Ind AC et al. (2009) Inducible-expression plasmid for Rhodobacter sphaeroides and Paracoccus denitrificans. Appl Environ Microbiol. 75(20):6613-5. [PMID:19684165]
Host bacterium
| ID | 656 | GenBank | FM164773 |
| Plasmid name | Expression plasmid pIND4 for Rhodobacter sphaeroides | Incompatibility group | ColRNAI |
| Plasmid size | 8367 bp | Coordinate of oriT [Strand] | |
| Host baterium | Expression |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |