Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300416 |
| Name | oriT_pRR54  |
| Organism | Cosmid vector pRR54 |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | AY297462 (_) |
| oriT length | 112 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RP4/RK2 |
oriT sequence
Download Length: 112 nt
>oriT_pRR54
TCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG
TCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Rahme LG et al. (1995) Common virulence factors for bacterial pathogenicity in plants and animals. Science. 268(5219):1899-902. [PMID:7604262]
Host bacterium
| ID | 629 | GenBank | AY297462 |
| Plasmid name | Cosmid vector pRR54 | Incompatibility group | IncP1 |
| Plasmid size | 10082 bp | Coordinate of oriT [Strand] | |
| Host baterium | Cosmid vector pRR54 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |