Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300415
Name   oriT_pFLP3 experimental
Organism   Flp expression vector pFLP3
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   AY597273 (_)
oriT length   257 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RK2

  oriT sequence  


Download         Length: 257 nt

>oriT_pFLP3
CCTTAAGGTATACTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGAT

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Choi KH et al. (2005) A Tn7-based broad-range bacterial cloning and expression system. Nat Methods. 2(6):443-8. [PMID:15908923]


Host bacterium


ID   628 GenBank   AY597273
Plasmid name   Flp expression vector pFLP3 Incompatibility group   ColRNAI
Plasmid size   10925 bp Coordinate of oriT [Strand]   
Host baterium   Flp expression vector pFLP3

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -