Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300414 |
| Name | oriT_pUC18R6KT  |
| Organism | Cloning and suicide delivery vector pUC18R6KT |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | AY884832 (_) |
| oriT length | 260 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RP4/RK2 |
oriT sequence
Download Length: 260 nt
>oriT_pUC18R6KT
TTAAGGTATACTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGATAAGCT
TTAAGGTATACTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGATAAGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Choi KH et al. (2005) A Tn7-based broad-range bacterial cloning and expression system. Nat Methods. 2(6):443-8. [PMID:15908923]
Host bacterium
| ID | 627 | GenBank | AY884832 |
| Plasmid name | Cloning and suicide delivery vector pUC18R6KT | Incompatibility group | - |
| Plasmid size | 2939 bp | Coordinate of oriT [Strand] | |
| Host baterium | Cloning and suicide delivery vector pUC18R6KT |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |