Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300410
Name   oriT_pCRE3 experimental
Organism   Site-specific excision vector pCRE3
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   EU215439 (_)
oriT length   257 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RK2

  oriT sequence  


Download         Length: 257 nt

>oriT_pCRE3
CCTTAAGGTATACTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGAT

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Choi KH et al. (2008) Genetic tools for select-agent-compliant manipulation of Burkholderia pseudomallei. Appl Environ Microbiol. 74(4):1064-75. [PMID:18156318]


Host bacterium


ID   623 GenBank   EU215439
Plasmid name   Site-specific excision vector pCRE3 Incompatibility group   ColRNAI
Plasmid size   6424 bp Coordinate of oriT [Strand]   
Host baterium   Site-specific excision vector pCRE3

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -