Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300407
Name   oriT_pBT20-Dbla-Tel-FRT in_silico
Organism   Vector pBT20-Dbla-Tel-FRT
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   EU626135 (_)
oriT length   242 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4/RK2

  oriT sequence  


Download         Length: 242 nt

>oriT_pBT20-Dbla-Tel-FRT
CGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCCGAAGCAGGGTTATGCAGCGGAAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Kang Y et al. (2009) Engineering of tellurite-resistant genetic tools for single-copy chromosomal analysis of Burkholderia spp. and characterization of the Burkholderia thailandensis betBA operon. Appl Environ Microbiol. 75(12):4015-27. [PMID:19376905]


Host bacterium


ID   620 GenBank   EU626135
Plasmid name   Vector pBT20-Dbla-Tel-FRT Incompatibility group   -
Plasmid size   6978 bp Coordinate of oriT [Strand]   
Host baterium   Vector pBT20-Dbla-Tel-FRT

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -