Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300406
Name   oriT_pFRT1-lacZ-Tel in_silico
Organism   Vector pFRT1-lacZ-Tel
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   EU626139 (_)
oriT length   230 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4/RK2

  oriT sequence  


Download         Length: 230 nt

>oriT_pFRT1-lacZ-Tel
TCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCCGAAGCAGGGTTATGCAGCGG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Kang Y et al. (2009) Engineering of tellurite-resistant genetic tools for single-copy chromosomal analysis of Burkholderia spp. and characterization of the Burkholderia thailandensis betBA operon. Appl Environ Microbiol. 75(12):4015-27. [PMID:19376905]


Host bacterium


ID   619 GenBank   EU626139
Plasmid name   Vector pFRT1-lacZ-Tel Incompatibility group   -
Plasmid size   8388 bp Coordinate of oriT [Strand]   
Host baterium   Vector pFRT1-lacZ-Tel

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -