Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300400
Name   oriT_pTNS3-asdEc experimental
Organism   Mini-Tn7 delivery vector pTNS3-asdEc
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   FJ797680 (_)
oriT length   260 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4

  oriT sequence  


Download         Length: 260 nt

>oriT_pTNS3-asdEc
AGCTTATCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCCGAAGCAGGGTTATGCAGCGGAAAGTATACCTTAA

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Kang Y et al. (2009) Engineering of tellurite-resistant genetic tools for single-copy chromosomal analysis of Burkholderia spp. and characterization of the Burkholderia thailandensis betBA operon. Appl Environ Microbiol. 75(12):4015-27. [PMID:19376905]


Host bacterium


ID   613 GenBank   FJ797680
Plasmid name   Mini-Tn7 delivery vector pTNS3-asdEc Incompatibility group   -
Plasmid size   10251 bp Coordinate of oriT [Strand]   
Host baterium   Mini-Tn7 delivery vector pTNS3-asdEc

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -