Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300399 |
| Name | oriT_pBINPLUS/ARS  |
| Organism | Binary vector pBINPLUS/ARS |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | DQ320121 (_) |
| oriT length | 111 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RP4/RK2 |
oriT sequence
Download Length: 111 nt
>oriT_pBINPLUS/ARS
AGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGC
AGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGC
Visualization of oriT structure
Reference
[1] Belknap W et al. (2008) pBINPLUS/ARS: an improved plant transformation vector based on pBINPLUS. Biotechniques. 44(6):753-6. [PMID:18476828]
Host bacterium
| ID | 612 | GenBank | DQ320121 |
| Plasmid name | Binary vector pBINPLUS/ARS | Incompatibility group | ColRNAI |
| Plasmid size | 12456 bp | Coordinate of oriT [Strand] | |
| Host baterium | Binary vector pBINPLUS/ARS |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |