Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300395
Name   oriT_mini-CTX-lacZ in_silico
Organism   Integration vector mini-CTX-lacZ
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   AF140579 (_)
oriT length   260 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4/RK2

  oriT sequence  


Download         Length: 260 nt

>oriT_mini-CTX-lacZ
AGCTTATCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCCGAAGCAGGGTTATGCAGCGGAAAGTATACCTTAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Hoang TT et al. (2000) Integration-proficient plasmids for Pseudomonas aeruginosa: site-specific integration and use for engineering of reporter and expression strains. Plasmid. 43(1):59-72. [PMID:10610820]


Host bacterium


ID   608 GenBank   AF140579
Plasmid name   Integration vector mini-CTX-lacZ Incompatibility group   ColRNAI
Plasmid size   8875 bp Coordinate of oriT [Strand]   
Host baterium   Integration vector mini-CTX-lacZ

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -