Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300394
Name   oriT_HKBS1 in_silico
Organism   Cloning vector HKBS1
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   AF251497 (_)
oriT length   260 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4/RK2

  oriT sequence  


Download         Length: 260 nt

>oriT_HKBS1
AGCTTATCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCCGAAGCAGGGTTATGCAGCGGAAAGTATACCTTAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Hoang TT et al. (2000) Integration-proficient plasmids for Pseudomonas aeruginosa: site-specific integration and use for engineering of reporter and expression strains. Plasmid. 43(1):59-72. [PMID:10610820]


Host bacterium


ID   607 GenBank   AF251497
Plasmid name   Cloning vector HKBS1 Incompatibility group   ColRNAI
Plasmid size   12538 bp Coordinate of oriT [Strand]   
Host baterium   Cloning vector HKBS1

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -