Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300382
Name   oriT_pUC18T-mini-Tn7T-LAC-Gm experimental
Organism   Expression vector pUC18T-mini-Tn7T-LAC-Gm
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   EU240902 (_)
oriT length   268 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4

  oriT sequence  


Download         Length: 268 nt

>oriT_pUC18T-mini-Tn7T-LAC-Gm
AGCTTATCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCCGAAGCAGGGTTATGCAGCGGAAAGTATACCTTAAGGAATCCC

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Choi KH et al. (2008) Genetic tools for select-agent-compliant manipulation of Burkholderia pseudomallei. Appl Environ Microbiol. 74(4):1064-75. [PMID:18156318]


Host bacterium


ID   595 GenBank   EU240902
Plasmid name   Expression vector pUC18T-mini-Tn7T-LAC-Gm Incompatibility group   ColRNAI
Plasmid size   6047 bp Coordinate of oriT [Strand]   
Host baterium   Expression vector pUC18T-mini-Tn7T-LAC-Gm

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -