Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300373 |
| Name | oriT_pEMCJH04  |
| Organism | Expression vector pEMCJH04 |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | AY453632 (_) |
| oriT length | 113 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | _ |
oriT sequence
Download Length: 113 nt
>oriT_pEMCJH04
GACCTGCGATTTTTACACGTTTATTTTTGTGGCTTGGTAACTATAGCAAACAGTCAAAACACACCAAAAATAAACCCTAACTAAGTATATTTTACCTGTGTTTTGACTGTTTG
GACCTGCGATTTTTACACGTTTATTTTTGTGGCTTGGTAACTATAGCAAACAGTCAAAACACACCAAAAATAAACCCTAACTAAGTATATTTTACCTGTGTTTTGACTGTTTG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Hays JP et al. (2005) A novel plasmid (pEMCJH03) isolated from moraxella catarrhalis possibly useful as a cloning and expression vector within this species. Plasmid. 53(3):263-8. [PMID:15848230]
Host bacterium
| ID | 586 | GenBank | AY453632 |
| Plasmid name | Expression vector pEMCJH04 | Incompatibility group | - |
| Plasmid size | 4740 bp | Coordinate of oriT [Strand] | |
| Host baterium | Expression vector pEMCJH04 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |