Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300372
Name   oriT_pUC18T-mini-Tn7T-Gm-REP experimental
Organism   Cloning vector pUC18T-mini-Tn7T-Gm-REP
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   AY712952 (_)
oriT length   268 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4

  oriT sequence  


Download         Length: 268 nt

>oriT_pUC18T-mini-Tn7T-Gm-REP
AGCTTATCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCCGAAGCAGGGTTATGCAGCGGAAAGTATACCTTAAGGAATCCC

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Choi KH et al. (2005) A Tn7-based broad-range bacterial cloning and expression system. Nat Methods. 2(6):443-8. [PMID:15908923]


Host bacterium


ID   585 GenBank   AY712952
Plasmid name   Cloning vector pUC18T-mini-Tn7T-Gm-REP Incompatibility group   ColRNAI
Plasmid size   4967 bp Coordinate of oriT [Strand]   
Host baterium   Cloning vector pUC18T-mini-Tn7T-Gm-REP

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -