Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300371
Name   oriT_pJY-mini-Tn7T-Sm experimental
Organism   Cloning vector pJY-mini-Tn7T-Sm
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   EF450773 (_)
oriT length   268 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4

  oriT sequence  


Download         Length: 268 nt

>oriT_pJY-mini-Tn7T-Sm
AGCTTATCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCCGAAGCAGGGTTATGCAGCGGAAAGTATACCTTAAGGAATCCC

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Yao J et al. (2007) The plant pathogen Ralstonia solanacearum needs aerotaxis for normal biofilm formation and interactions with its tomato host. J Bacteriol. 189(17):6415-24. [PMID:17601784]


Host bacterium


ID   584 GenBank   EF450773
Plasmid name   Cloning vector pJY-mini-Tn7T-Sm Incompatibility group   ColRNAI
Plasmid size   5533 bp Coordinate of oriT [Strand]   
Host baterium   Cloning vector pJY-mini-Tn7T-Sm

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -