Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300368 |
| Name | oriT_pVec8-GFP  |
| Organism | Binary vector pVec8-GFP |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | FJ949107 (_) |
| oriT length | 249 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | _ |
oriT sequence
Download Length: 249 nt
>oriT_pVec8-GFP
GGATCTTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGG
GGATCTTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Murray F et al. (2004) Comparison of Agrobacterium-mediated transformation of four barley cultivars using the GFP and GUS reporter genes. Plant Cell Rep. 22(6):397-402. [PMID:14530864]
Host bacterium
| ID | 581 | GenBank | FJ949107 |
| Plasmid name | Binary vector pVec8-GFP | Incompatibility group | IncP1 |
| Plasmid size | 14559 bp | Coordinate of oriT [Strand] | |
| Host baterium | Binary vector pVec8-GFP |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |