Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300367
Name   oriT_mini-Tn7-Tel experimental
Organism   Vector mini-Tn7-Tel
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   EU626136 (_)
oriT length   230 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4

  oriT sequence  


Download         Length: 230 nt

>oriT_mini-Tn7-Tel
TCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCCGAAGCAGGGTTATGCAGCGG

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Kang Y et al. (2009) Engineering of tellurite-resistant genetic tools for single-copy chromosomal analysis of Burkholderia spp. and characterization of the Burkholderia thailandensis betBA operon. Appl Environ Microbiol. 75(12):4015-27. [PMID:19376905]


Host bacterium


ID   580 GenBank   EU626136
Plasmid name   Vector mini-Tn7-Tel Incompatibility group   -
Plasmid size   5972 bp Coordinate of oriT [Strand]   
Host baterium   Vector mini-Tn7-Tel

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -