Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300366
Name   oriT_mini-Tn7-gat experimental
Organism   Vector mini-Tn7-gat
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   FJ858785 (_)
oriT length   230 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4

  oriT sequence  


Download         Length: 230 nt

>oriT_mini-Tn7-gat
TCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCCGAAGCAGGGTTATGCAGCGG

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Norris MH et al. (2009) Glyphosate resistance as a novel select-agent-compliant, non-antibiotic-selectable marker in chromosomal mutagenesis of the essential genes asd and dapB of Burkholderia pseudomallei. Appl Environ Microbiol. 75(19):6062-75. [PMID:19648360]


Host bacterium


ID   579 GenBank   FJ858785
Plasmid name   Vector mini-Tn7-gat Incompatibility group   -
Plasmid size   2537 bp Coordinate of oriT [Strand]   
Host baterium   Vector mini-Tn7-gat

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -