Detailed information of oriT

oriT

The information of the oriT region


oriTDB ID   300365
Name   oriT_pUC18T-mini-Tn7T experimental
Organism   Cloning vector pUC18T-mini-Tn7T
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   AY599230 (_)
oriT length   268 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site    		  
Note   oriT_RP4

  oriT sequence  


Download         Length: 268 nt

>oriT_pUC18T-mini-Tn7T
AGCTTATCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCCGAAGCAGGGTTATGCAGCGGAAAGTATACCTTAAGGAATCCC

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Choi KH et al. (2005) A Tn7-based broad-range bacterial cloning and expression system. Nat Methods. 2(6):443-8. [PMID:15908923]


Host bacterium

ID   578 GenBank   AY599230
Plasmid name   Cloning vector pUC18T-mini-Tn7T Incompatibility group   ColRNAI
Plasmid size   3515 bp Coordinate of oriT [Strand]   
Host baterium   Cloning vector pUC18T-mini-Tn7T

Cargo genes

Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -