Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 300354 |
Name | oriT_pUC18T-mini-Tn7T-Tp-DsRedExpress |
Organism | Mini-Tn7 delivery vector pUC18T-mini-Tn7T-Tp-DsRedExpress |
Sequence Completeness | |
NCBI accession of oriT (coordinates [strand]) | DQ493884 (_) |
oriT length | 269 nt |
IRs (inverted repeats) | |
Location of nic site | |
Conserved sequence flanking the nic site |
|
Note | oriT_RP4 |
oriT sequence
Download Length: 269 nt
>oriT_pUC18T-mini-Tn7T-Tp-DsRedExpress
AGCTTATCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCCGAAGCAGGGTTATGCAGCGGAAAGTATACCTTAAGGAATCCCC
AGCTTATCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCCGAAGCAGGGTTATGCAGCGGAAAGTATACCTTAAGGAATCCCC
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure fileReference
[1] Choi KH et al. (2006) Mini-Tn7 insertion in bacteria with single attTn7 sites: example Pseudomonas aeruginosa. Nat Protoc. 1(1):153-61. [PMID:17406227]
Host bacterium
ID | 567 | GenBank | DQ493884 |
Plasmid name | Mini-Tn7 delivery vector pUC18T-mini-Tn7T-Tp-DsRedExpress | Incompatibility group | ColRNAI |
Plasmid size | 5518 bp | Coordinate of oriT [Strand] | |
Host baterium | Mini-Tn7 delivery vector pUC18T-mini-Tn7T-Tp-DsRedExpress |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |