Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300354
Name   oriT_pUC18T-mini-Tn7T-Tp-DsRedExpress experimental
Organism   Mini-Tn7 delivery vector pUC18T-mini-Tn7T-Tp-DsRedExpress
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   DQ493884 (_)
oriT length   269 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4

  oriT sequence  


Download         Length: 269 nt

>oriT_pUC18T-mini-Tn7T-Tp-DsRedExpress
AGCTTATCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCCGAAGCAGGGTTATGCAGCGGAAAGTATACCTTAAGGAATCCCC

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Choi KH et al. (2006) Mini-Tn7 insertion in bacteria with single attTn7 sites: example Pseudomonas aeruginosa. Nat Protoc. 1(1):153-61. [PMID:17406227]


Host bacterium


ID   567 GenBank   DQ493884
Plasmid name   Mini-Tn7 delivery vector pUC18T-mini-Tn7T-Tp-DsRedExpress Incompatibility group   ColRNAI
Plasmid size   5518 bp Coordinate of oriT [Strand]   
Host baterium   Mini-Tn7 delivery vector pUC18T-mini-Tn7T-Tp-DsRedExpress

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -