Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300350
Name   oriT_pUC18T-mini-Tn7T-Zeo-DsRedExpress experimental
Organism   Mini-Tn7 delivery vector pUC18T-mini-Tn7T-Zeo-DsRedExpress
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   DQ493888 (_)
oriT length   269 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4

  oriT sequence  


Download         Length: 269 nt

>oriT_pUC18T-mini-Tn7T-Zeo-DsRedExpress
AGCTTATCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCCGAAGCAGGGTTATGCAGCGGAAAGTATACCTTAAGGAATCCCC

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Choi KH et al. (2008) Genetic tools for select-agent-compliant manipulation of Burkholderia pseudomallei. Appl Environ Microbiol. 74(4):1064-75. [PMID:18156318]


Host bacterium


ID   563 GenBank   DQ493888
Plasmid name   Mini-Tn7 delivery vector pUC18T-mini-Tn7T-Zeo-DsRedExpress Incompatibility group   ColRNAI
Plasmid size   5377 bp Coordinate of oriT [Strand]   
Host baterium   Mini-Tn7 delivery vector pUC18T-mini-Tn7T-Zeo-DsRedExpress

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -