Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300348
Name   oriT_pRKaraRed experimental
Organism   Broad host range Red recombinase vector pRKaraRed
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   GU186864 (_)
oriT length   372 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RK2

  oriT sequence  


Download         Length: 372 nt

>oriT_pRKaraRed
GATGGCTGATGAAACCAAGCCAACCAGGAAGGGCAGCCCACCTATCAAGGTGTACTGCCTTCCAGACGAACGAAGAGCGATTGAGGAAAAGGCGGCGGCGGCCGGCATGAGCCTGTCGGCCTACCTGCTGGCCGTCGGCCAGGGCTACAAAATCACGGGCGTCGTGGACTATGAGCACGTCCGCGAGCTGGCCCGCATCAATGGCGACCTGGGCCGCCTGGGCGGCCTGCTGAAACTCTGGCTCACCGACGACCCGCGCACGGCGCGGTTCGGTGATGCCACGATCCTCGCCCTGCTGGCGAAGATCGAAGAGAAGCAGGACGAGCTTGGCAAGGTCATGATGGGCGTGGTCCGCCCGAGGGCAGAGCCATG

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Liang R et al. (2010) Scarless and sequential gene modification in Pseudomonas using PCR product flanked by short homology regions. BMC Microbiol. 0.561805556. [PMID:20682065]


Host bacterium


ID   561 GenBank   GU186864
Plasmid name   Broad host range Red recombinase vector pRKaraRed Incompatibility group   IncP1
Plasmid size   10903 bp Coordinate of oriT [Strand]   
Host baterium   Broad host range Red recombinase vector pRKaraRed

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -