Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300347
Name   oriT_pAM3G experimental
Organism   Cloning vector pAM3G
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   GU074522 (_)
oriT length   268 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4

  oriT sequence  


Download         Length: 268 nt

>oriT_pAM3G
GGGATTCCTTAAGGTATACTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGATAAGCT

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Kang Y et al. (2011) Knockout and pullout recombineering for naturally transformable Burkholderia thailandensis and Burkholderia pseudomallei. Nat Protoc. 6(8):1085-104. [PMID:21738123]


Host bacterium


ID   560 GenBank   GU074522
Plasmid name   Cloning vector pAM3G Incompatibility group   ColRNAI
Plasmid size   3323 bp Coordinate of oriT [Strand]   
Host baterium   Cloning vector pAM3G

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -