Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300345 |
| Name | oriT_pRK415iq  |
| Organism | Broad host range expression vector pRK415iq |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | EF435043 (_) |
| oriT length | 110 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RK2 |
oriT sequence
Download Length: 110 nt
>oriT_pRK415iq
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCC
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCC
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Kickstein E et al. (2007) Deletions of recBCD or recD influence genetic transformation differently and are lethal together with a recJ deletion in Acinetobacter baylyi. Microbiology. 153(Pt 7):2259-70. [PMID:17600070]
Host bacterium
| ID | 558 | GenBank | EF435043 |
| Plasmid name | Broad host range expression vector pRK415iq | Incompatibility group | IncP1 |
| Plasmid size | 11912 bp | Coordinate of oriT [Strand] | |
| Host baterium | Broad host range expression vector pRK415iq |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |