Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300344 |
| Name | oriT_pNT1  |
| Organism | Cloning vector pNT1 |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | HQ010044 (_) |
| oriT length | 42 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | _ |
oriT sequence
Download Length: 42 nt
>oriT_pNT1
GCACATTTACGAAGTAAAGTATAGTGCGTTATACTTTACATG
GCACATTTACGAAGTAAAGTATAGTGCGTTATACTTTACATG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Vaillancourt K et al. (2008) Role of galK and galM in galactose metabolism by Streptococcus thermophilus. Appl Environ Microbiol. 74(4):1264-7. [PMID:18065633]
Host bacterium
| ID | 557 | GenBank | HQ010044 |
| Plasmid name | Cloning vector pNT1 | Incompatibility group | - |
| Plasmid size | 3697 bp | Coordinate of oriT [Strand] | |
| Host baterium | Cloning vector pNT1 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |