Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300343 |
| Name | oriT_pQLICE  |
| Organism | Broad-host-range expression vector pQLICE |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | EF189157 (_) |
| oriT length | 157 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RSF1010 |
oriT sequence
Download Length: 157 nt
>oriT_pQLICE
TCGAGCTTGGCCAGCCGATCCGCCGCCTTGTTGCTCCCCTTAACCATCTTGACACCCCATTGTTAATGTGCTGTCTCGTAGGCTATCATGGAGGCACAGCGGCGGCAATCCCGACCCTACTTTGTAGGGGAGGGCGCACTTACCGGTTTCTCTTCGA
TCGAGCTTGGCCAGCCGATCCGCCGCCTTGTTGCTCCCCTTAACCATCTTGACACCCCATTGTTAATGTGCTGTCTCGTAGGCTATCATGGAGGCACAGCGGCGGCAATCCCGACCCTACTTTGTAGGGGAGGGCGCACTTACCGGTTTCTCTTCGA
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Harms K et al. (2007) The RecJ DNase strongly suppresses genomic integration of short but not long foreign DNA fragments by homology-facilitated illegitimate recombination during transformation of Acinetobacter baylyi. Mol Microbiol. 64(3):691-702. [PMID:17462017]
Host bacterium
| ID | 556 | GenBank | EF189157 |
| Plasmid name | Broad-host-range expression vector pQLICE | Incompatibility group | IncQ1 |
| Plasmid size | 10546 bp | Coordinate of oriT [Strand] | |
| Host baterium | Broad-host-range expression vector pQLICE |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |