Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300340 |
| Name | oriT_pUT399-abrB  |
| Organism | R6K-based suicide vector pUT399-abrB |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | AB610285 (_) |
| oriT length | 99 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RP4 |
oriT sequence
Download Length: 99 nt
>oriT_pUT399-abrB
GAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACA
GAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACA
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Hara Y et al. (2012) The complete genome sequence of Pantoea ananatis AJ13355, an organism with great biotechnological potential. Appl Microbiol Biotechnol. 93(1):331-41. [PMID:22159605]
Host bacterium
| ID | 553 | GenBank | AB610285 |
| Plasmid name | R6K-based suicide vector pUT399-abrB | Incompatibility group | - |
| Plasmid size | 4916 bp | Coordinate of oriT [Strand] | |
| Host baterium | R6K-based suicide vector pUT399-abrB |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |