Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300339
Name   oriT_pEMG experimental
Organism   Gene deletion vector pEMG
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   JF965437 (_)
oriT length   243 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4/RK2

  oriT sequence  


Download         Length: 243 nt

>oriT_pEMG
TTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCG

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Martínez-García E et al. (2011) Engineering multiple genomic deletions in Gram-negative bacteria: analysis of the multi-resistant antibiotic profile of Pseudomonas putida KT2440. Environ Microbiol. 13(10):2702-16. [PMID:21883790]


Host bacterium


ID   552 GenBank   JF965437
Plasmid name   Gene deletion vector pEMG Incompatibility group   -
Plasmid size   3168 bp Coordinate of oriT [Strand]   
Host baterium   Gene deletion vector pEMG

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -