Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300338 |
| Name | oriT_pAB707  |
| Organism | Cloning vector pAB707 |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | JN005928 (1044..1153 [-], 110 nt) |
| oriT length | 110 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RP4/RK2 |
oriT sequence
Download Length: 110 nt
>oriT_pAB707
CGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG
CGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Murakami T et al. (2011) A system for the targeted amplification of bacterial gene clusters multiplies antibiotic yield in Streptomyces coelicolor. Proc Natl Acad Sci U S A. 108(38):16020-5. [PMID:21903924]
Host bacterium
| ID | 551 | GenBank | JN005928 |
| Plasmid name | Cloning vector pAB707 | Incompatibility group | ColRNAI |
| Plasmid size | 7406 bp | Coordinate of oriT [Strand] | 1044..1153 [-] |
| Host baterium | Cloning vector pAB707 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |