Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300337 |
| Name | oriT_pMMS  |
| Organism | Expression vector pMMS |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | HQ215594 (_) |
| oriT length | 88 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RSF1010 |
oriT sequence
Download Length: 88 nt
>oriT_pMMS
GTAGGCTATCATGGAGGCACAGCGGCGGCAATCCCGACCCTACTTTGTAGGGGAGGGCGCACTTACCGGTTTCTCTTCGAGAAACTGG
GTAGGCTATCATGGAGGCACAGCGGCGGCAATCCCGACCCTACTTTGTAGGGGAGGGCGCACTTACCGGTTTCTCTTCGAGAAACTGG
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Tao F et al. (2011) Novel organic solvent-responsive expression vectors for biocatalysis: application for development of an organic solvent-tolerant biodesulfurizing strain. Bioresour Technol. 102(20):9380-7. [PMID:21875790]
Host bacterium
| ID | 550 | GenBank | HQ215594 |
| Plasmid name | Expression vector pMMS | Incompatibility group | IncQ1 |
| Plasmid size | 8367 bp | Coordinate of oriT [Strand] | |
| Host baterium | Expression vector pMMS |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |