Detailed information of oriT

oriT


The information of the oriT region


Loading, please wait
oriTDB ID   300336
Name   oriT_pMMRS experimental
Organism   Expression vector pMMRS
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   HQ215595 (_)
oriT length   88 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RSF1010

  oriT sequence  


Download         Length: 88 nt

>oriT_pMMRS
GTAGGCTATCATGGAGGCACAGCGGCGGCAATCCCGACCCTACTTTGTAGGGGAGGGCGCACTTACCGGTTTCTCTTCGAGAAACTGG

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Tao F et al. (2011) Novel organic solvent-responsive expression vectors for biocatalysis: application for development of an organic solvent-tolerant biodesulfurizing strain. Bioresour Technol. 102(20):9380-7. [PMID:21875790]


Host bacterium


ID   549 GenBank   HQ215595
Plasmid name   Expression vector pMMRS Incompatibility group   IncQ1
Plasmid size   10047 bp Coordinate of oriT [Strand]   
Host baterium   Expression vector pMMRS

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -