Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300334
Name   oriT_pBAM1-GFP experimental
Organism   Cloning vector pBAM1-GFP
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   HQ908072 (_)
oriT length   244 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4/RK2

  oriT sequence  


Download         Length: 244 nt

>oriT_pBAM1-GFP
CGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCCGAAGCAGGGTTATGCAGCGGAAAAG

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Martínez-García E et al. (2011) pBAM1: an all-synthetic genetic tool for analysis and construction of complex bacterial phenotypes. BMC Microbiol. 0.484722222. [PMID:21342504]


Host bacterium


ID   547 GenBank   HQ908072
Plasmid name   Cloning vector pBAM1-GFP Incompatibility group   -
Plasmid size   5023 bp Coordinate of oriT [Strand]   
Host baterium   Cloning vector pBAM1-GFP

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -