Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300250
Name   oriT_pSEVA247C experimental
Organism   Cloning vector pSEVA247C
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   JX560404 (_)
oriT length   246 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4

  oriT sequence  


Download         Length: 246 nt

>oriT_pSEVA247C
CTTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGTA

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Silva-Rocha R et al. (2013) The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Res. 41(Database issue):D666-75. [PMID:23180763]


Host bacterium


ID   463 GenBank   JX560404
Plasmid name   Cloning vector pSEVA247C Incompatibility group   ColRNAI
Plasmid size   4272 bp Coordinate of oriT [Strand]   
Host baterium   Cloning vector pSEVA247C

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -