Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300243
Name   oriT_pTJ1 experimental
Organism   Cloning vector pTJ1
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   JX559783 (_)
oriT length   269 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4

  oriT sequence  


Download         Length: 269 nt

>oriT_pTJ1
AGCTTATCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCCGAAGCAGGGTTATGCAGCGGAAAGTATACCTTAAGGAATCCCC

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Damron FH et al. (2013) Construction of a broad-host-range Tn7-based vector for single-copy PBAD-controlled gene expression in gram-negative bacteria. Appl Environ Microbiol. 79(2):718-21. [PMID:23124231]


Host bacterium


ID   456 GenBank   JX559783
Plasmid name   Cloning vector pTJ1 Incompatibility group   ColRNAI
Plasmid size   5667 bp Coordinate of oriT [Strand]   
Host baterium   Cloning vector pTJ1

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -