Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300242 |
| Name | oriT_pMMPc  |
| Organism | Expression vector pMMPc |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | KC544266 (_) |
| oriT length | 88 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RSF1010 |
oriT sequence
Download Length: 88 nt
>oriT_pMMPc
GTAGGCTATCATGGAGGCACAGCGGCGGCAATCCCGACCCTACTTTGTAGGGGAGGGCGCACTTACCGGTTTCTCTTCGAGAAACTGG
GTAGGCTATCATGGAGGCACAGCGGCGGCAATCCCGACCCTACTTTGTAGGGGAGGGCGCACTTACCGGTTTCTCTTCGAGAAACTGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Xu Y et al. (2013) New constitutive vectors: useful genetic engineering tools for biocatalysis. Appl Environ Microbiol. 79(8):2836-40. [PMID:23416993]
Host bacterium
| ID | 455 | GenBank | KC544266 |
| Plasmid name | Expression vector pMMPc | Incompatibility group | IncQ1 |
| Plasmid size | 8306 bp | Coordinate of oriT [Strand] | |
| Host baterium | Expression vector pMMPc |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |